SubtiBank SubtiBank
Version comparison:

2019-12-28 16:19:222025-04-07 05:19:23

description

primary bacitracin resistance determinant, [SW|ABC transporter] (permease) for the export of bacitracin, plectasin, mersacidin and actagardine, sensory component of the Bce regulatory & detoxification system

primary bacitracin resistance determinant, [SW|ABC transporter] (permease), sensory component of the Bce regulatory & detoxification system, protects cell wall biosynthetic targets from inhibition by antimicrobial peptides

function

export of toxic peptides

protection of cell wall biosynthetic targets from inhibition by antimicrobial peptides

product

bacitracin [SW|ABC transporter] (permease)

[SW|ABC transporter] for target protection of cell wall synthesis

The protein

Catalyzed reaction/ biological activity

binds bacitracin, KD: 60 nM [Pubmed|25118291]

inhibits [[protein|BceS]] autophosphorylation activity in the absence of bacitracin [Pubmed|25118291]

binds bacitracin, KD: 60 nM [Pubmed|25118291]

inhibits [[protein|BceS]] autophosphorylation activity in the absence of bacitracin [Pubmed|25118291]

releaves intermediates of the lipid II cycle from the inhibitory interaction with antimicrobial peptides such as bacitracin [pubmed|31871088]

Biological materials

Mutant

MGNA-A168 (ytsD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/168 NBRP B. subtilis, Japan]

BKE30370 (Δ[[gene|bceB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG

BKK30370 (Δ[[gene|bceB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG

GP3218 Δ([[gene|bceR]]-[[gene|bceS]]-[[gene|bceA]]-[[gene|bceB]])::''cat'', available in [SW|Jörg Stülke]'s lab

MGNA-A168 (ytsD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/168 NBRP B. subtilis, Japan]

BKE30370 (Δ[[gene|bceB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG

BKK30370 (Δ[[gene|bceB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG

References

Original publications

18394148, 17905982, 12890034, 14651641, 10092453, 14612242, 21283517, 20606066, 21078927, 23687272, 25118291, 24806199, 26199330, 26815905

18394148, 17905982, 12890034, 14651641, 10092453, 14612242, 21283517, 20606066, 21078927, 23687272, 25118291, 24806199, 26199330, 26815905, 31871088, 32019833, 32955745

labs

[SW|Susanne Gebhard], Bath, UK