2019-12-28 16:19:222025-04-07 05:19:23
description
primary bacitracin resistance determinant, [SW|ABC transporter] (permease) for the export of bacitracin, plectasin, mersacidin and actagardine, sensory component of the Bce regulatory & detoxification system
primary bacitracin resistance determinant, [SW|ABC transporter] (permease), sensory component of the Bce regulatory & detoxification system, protects cell wall biosynthetic targets from inhibition by antimicrobial peptides
function
export of toxic peptides
protection of cell wall biosynthetic targets from inhibition by antimicrobial peptides
product
bacitracin [SW|ABC transporter] (permease)
[SW|ABC transporter] for target protection of cell wall synthesis
The protein
Catalyzed reaction/ biological activity
binds bacitracin, KD: 60 nM [Pubmed|25118291]
inhibits [[protein|BceS]] autophosphorylation activity in the absence of bacitracin [Pubmed|25118291]
binds bacitracin, KD: 60 nM [Pubmed|25118291]
inhibits [[protein|BceS]] autophosphorylation activity in the absence of bacitracin [Pubmed|25118291]
releaves intermediates of the lipid II cycle from the inhibitory interaction with antimicrobial peptides such as bacitracin [pubmed|31871088]
Biological materials
Mutant
MGNA-A168 (ytsD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/168 NBRP B. subtilis, Japan]
BKE30370 (Δ[[gene|bceB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
BKK30370 (Δ[[gene|bceB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
GP3218 Δ([[gene|bceR]]-[[gene|bceS]]-[[gene|bceA]]-[[gene|bceB]])::''cat'', available in [SW|Jörg Stülke]'s lab
MGNA-A168 (ytsD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/168 NBRP B. subtilis, Japan]
BKE30370 (Δ[[gene|bceB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
BKK30370 (Δ[[gene|bceB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAATGTTCATGCTGCAC, downstream forward: _UP4_TGAAACAGAAAAAGCTCCAG
References
Original publications
labs
[SW|Susanne Gebhard], Bath, UK